header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-161214-168
CRISPR Name: CRISPR6-afdna
Target: afdna (2)
Previous Names: CRISPR6-mllt4a, Z000648 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGAAGCGGCAGGTCGGTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR6-afdna No data available
GENOMIC FEATURES CREATED WITH CRISPR6-afdnaNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR6-afdna No data available
PHENOTYPE
Phenotype resulting from CRISPR6-afdna
No data available

Phenotype of all Fish created by or utilizing CRISPR6-afdna
No data available
OTHER CRISPR6-afdna CRISPR PAGES
  • CRISPRz:Z000648 (1)
  • CITATIONS (2)