ZFIN ID: ZDB-CRISPR-161116-1
CRISPR Name: CRISPR1-znf644b
Target: znf644b (1)
Source:
Target Sequence:
5' - GGCTCCATTTGATCAGCGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-znf644b No data available
GENOMIC FEATURES CREATED WITH CRISPR1-znf644b
Genomic Feature Affected Genomic Regions    
uot5 znf644b    
uot6 znf644b    
uot7 znf644b    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-znf644b No data available
PHENOTYPE
Phenotype resulting from CRISPR1-znf644b
No data available

Phenotype of all Fish created by or utilizing CRISPR1-znf644b
No data available
OTHER CRISPR1-znf644b CRISPR PAGESNo links to external sites
CITATIONS (1)