ZFIN ID: ZDB-CRISPR-161019-9
CRISPR Name: CRISPR5-tyr
Target: tyr (1)
Source:
Target Sequence:
5' - AGCTCTTCAGCTCGTCTCTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR5-tyr No data available
GENOMIC FEATURES CREATED WITH CRISPR5-tyrNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR5-tyr No data available
PHENOTYPE
Phenotype resulting from CRISPR5-tyr
Phenotype Figures
whole organism lacks parts or has fewer parts of type melanocyte, abnormal Fig. 1 with image from Feng et al., 2016

Phenotype of all Fish created by or utilizing CRISPR5-tyr
Phenotype Fish Conditions Figures
whole organism lacks parts or has fewer parts of type melanocyte, abnormal TU + CRISPR5-tyr standard conditions Fig. 1 with image from Feng et al., 2016
OTHER CRISPR5-tyr CRISPR PAGESNo links to external sites
CITATIONS (1)