ZFIN ID: ZDB-CRISPR-160802-2
CRISPR Name: CRISPR2-ubr3
Target: ubr3 (1)
Source:
Target Sequence:
5' - GGCGTTATCGTAGGATCGGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-ubr3 No data available
GENOMIC FEATURES CREATED WITH CRISPR2-ubr3
Genomic Feature Affected Genomic Regions    
b1251 ubr3    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-ubr3 No data available
PHENOTYPE 
Phenotype resulting from CRISPR2-ubr3
No data available

Phenotype of all Fish created by or utilizing CRISPR2-ubr3
Phenotype Fish Conditions Figures
optic vesicle epithelium morphology, abnormal ubr3b1250/+ ; ubr3b1251/+ standard conditions Fig. 7 with image from Li et al., 2016
optic vesicle epithelium disorganized, abnormal ubr3b1250/+ ; ubr3b1251/+ standard conditions Fig. 7 with image from Li et al., 2016
whole organism has extra parts of type Rohon-Beard neuron, abnormal ubr3b1250/+ ; ubr3b1251/+ standard conditions Fig. S5 with image from Li et al., 2016
immature eye ptch2 expression decreased amount, abnormal ubr3b1250/+ ; ubr3b1251/+ standard conditions Fig. 7 with image from Li et al., 2016
somite U-shaped, abnormal ubr3b1250/+ ; ubr3b1251/+ standard conditions Fig. S5 with image from Li et al., 2016
somite morphology, abnormal ubr3b1250/+ ; ubr3b1251/+ standard conditions Fig. S5 with image from Li et al., 2016
OTHER CRISPR2-ubr3 CRISPR PAGESNo links to external sites
CITATIONS (1)