ZFIN ID: ZDB-CRISPR-160602-1
CRISPR Name: CRISPR1-rcbtb1
Target: rcbtb1 (1)
Previous Name: gRNA-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - AGAGCTCCTGTGCACTCAAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-rcbtb1 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-rcbtb1No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-rcbtb1 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-rcbtb1
Phenotype Figures
eye vasculature development disrupted, abnormal Fig. S7 from Wu et al., 2016
ocular blood vessel decreased thickness, abnormal Fig. S7 from Wu et al., 2016
ocular blood vessel blood vessel lumenization disrupted, abnormal Fig. S7 from Wu et al., 2016

Phenotype of all Fish created by or utilizing CRISPR1-rcbtb1
Phenotype Fish Conditions Figures
ocular blood vessel decreased thickness, abnormal y1Tg + CRISPR1-rcbtb1 standard conditions Fig. S7 from Wu et al., 2016
eye vasculature development disrupted, abnormal y1Tg + CRISPR1-rcbtb1 standard conditions Fig. S7 from Wu et al., 2016
ocular blood vessel blood vessel lumenization disrupted, abnormal y1Tg + CRISPR1-rcbtb1 standard conditions Fig. S7 from Wu et al., 2016
OTHER CRISPR1-rcbtb1 CRISPR PAGESNo links to external sites
CITATIONS (1)