ZFIN ID: ZDB-CRISPR-160527-32
CRISPR Name: CRISPR5-ash2l
Target: ash2l (1)
Source:
Target Sequence:
5' - GGATCCTCATGCTCCCGACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR5-ash2l No data available
GENOMIC FEATURES CREATED WITH CRISPR5-ash2lNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR5-ash2l No data available
PHENOTYPE
Phenotype resulting from CRISPR5-ash2l
No data available

Phenotype of all Fish created by or utilizing CRISPR5-ash2l
No data available
OTHER CRISPR5-ash2l CRISPR PAGESNo links to external sites
CITATIONS (1)