ZFIN ID: ZDB-CRISPR-160506-1
CRISPR Name: CRISPR3-tardbp
Target: tardbp (1)
Source:
Target Sequence:
5' - GGCAGCAGCTCAGCTGCTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR3-tardbp No data available
GENOMIC FEATURES CREATED WITH CRISPR3-tardbpNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR3-tardbp No data available
PHENOTYPE
Phenotype resulting from CRISPR3-tardbp
No data available

Phenotype of all Fish created by or utilizing CRISPR3-tardbp
No data available
OTHER CRISPR3-tardbp CRISPR PAGESNo links to external sites
CITATIONS (1)