CRISPR

CRISPR3-esco2

ID
ZDB-CRISPR-151203-21
Name
CRISPR3-esco2
Previous Names
None
Target
Sequence
5' - GGGTCTTCAGTCTGATGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR3-esco2
No data available
Phenotype
Phenotype resulting from CRISPR3-esco2
No data available
Phenotype of all Fish created by or utilizing CRISPR3-esco2
No data available
Citations