ZFIN ID: ZDB-CRISPR-151109-1
CRISPR Name: CRISPR1-ncor2
Target: ncor2 (1)
Source:
Target Sequence:
5' - GAGGCTGGACCAGAGATCCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-ncor2 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-ncor2No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-ncor2 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-ncor2
No data available

Phenotype of all Fish created by or utilizing CRISPR1-ncor2
No data available
OTHER CRISPR1-ncor2 CRISPR PAGESNo links to external sites
CITATIONS (1)