header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-151021-10
CRISPR Name: CRISPR2-smpx
Target: smpx (2)
Previous Names: smpx-T2 (1), Z000144 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGCAGAGGCTTCTTCTCTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-smpx No data available
GENOMIC FEATURES CREATED WITH CRISPR2-smpxNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-smpx No data available
PHENOTYPE
Phenotype resulting from CRISPR2-smpx
No data available

Phenotype of all Fish created by or utilizing CRISPR2-smpx
No data available
OTHER CRISPR2-smpx CRISPR PAGES
  • CRISPRz:Z000144 (1)
  • CITATIONS (2)