ZFIN ID: ZDB-CRISPR-151015-1
CRISPR Name: CRISPR1-cdh23
Target: cdh23 (1)
Previous Name: cdh23-T1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GAGGAATCGTCACTGTGACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-cdh23 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-cdh23No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-cdh23 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-cdh23
No data available

Phenotype of all Fish created by or utilizing CRISPR1-cdh23
No data available
OTHER CRISPR1-cdh23 CRISPR PAGESNo links to external sites
CITATIONS (1)