ZFIN ID: ZDB-CRISPR-150427-2
CRISPR Name: CRISPR1-nlrc5
Target: nlrc5 (1)
Source:
Target Sequence:
5' - GGTGGACTTGCTCTGCGAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-nlrc5 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-nlrc5
Genomic Feature Affected Genomic Regions    
ihb48 nlrc5    
ihb49 nlrc5    
ihb51 nlrc5    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-nlrc5 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-nlrc5
No data available

Phenotype of all Fish created by or utilizing CRISPR1-nlrc5
No data available
OTHER CRISPR1-nlrc5 CRISPR PAGESNo links to external sites
CITATIONS (2)