header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-150323-6
CRISPR Name: CRISPR3-en1b
Target: en1b (1)
Previous Name: CRISPR3-eng1b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGAGTGGATTTAACATTCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This construct contains a mismatch at the 5'end A to G.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR3-en1b No data available
GENOMIC FEATURES CREATED WITH CRISPR3-en1b No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR3-en1b No data available
PHENOTYPE
Phenotype resulting from CRISPR3-en1b
No data available

Phenotype of all Fish created by or utilizing CRISPR3-en1b
No data available
OTHER CRISPR3-en1b CRISPR PAGES No links to external sites
CITATIONS (1)