ZFIN ID: ZDB-CRISPR-150323-11
CRISPR Name: CRISPR1-slc17a6b
Target: slc17a6b (1)
Source:
Target Sequence:
5' - GGGGGGAAACACCCCTGATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-slc17a6b No data available
GENOMIC FEATURES CREATED WITH CRISPR1-slc17a6bNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-slc17a6b No data available
PHENOTYPE
Phenotype resulting from CRISPR1-slc17a6b
No data available

Phenotype of all Fish created by or utilizing CRISPR1-slc17a6b
No data available
OTHER CRISPR1-slc17a6b CRISPR PAGESNo links to external sites
CITATIONS (1)