ZFIN ID: ZDB-CRISPR-140811-14
CRISPR Name: CRISPR2-ash2l
Target: ash2l (1)
Source:
Target Sequence:
5' - GGCTGCTGCTATTTGAAAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This CRISPR contains a mismatch at the 5' end A to G.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-ash2l No data available
GENOMIC FEATURES CREATED WITH CRISPR2-ash2lNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-ash2l No data available
PHENOTYPE
Phenotype resulting from CRISPR2-ash2l
No data available

Phenotype of all Fish created by or utilizing CRISPR2-ash2l
No data available
OTHER CRISPR2-ash2l CRISPR PAGESNo links to external sites
CITATIONS (1)