ZFIN ID: ZDB-CDNA-080114-37
cDNA Name: cssl:d163
Sequence Ontology ID : SO:0000756
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 500
Cloning Site: 5' NotI 3'AscI
Vector Type: Plasmid
Vector: pTT3
Polymerase: T7 RNA polymerase
PCR Amplification: 5'ACAGGTGTCCACTCCCAGGTCCAAG 3'
5'GGATCCTAATACGACTCACTATAGGGAGGCCGTGATGGAGGTCGACGGCG3'
Source:
Wright Lab (order this)
Quality: Rating 2 ( Weak expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (10 images) from Thisse et al., 2008 [cssl:d163]
MARKER RELATIONSHIPS
cssl:d163 Is Encoded by: [Gene] cd276 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CU458928 (1) 2168bp
Polypeptide GenPept:CAM73189 (1) 300aa
Select Tool
OTHER cssl:d163 cDNA PAGESNo links to external sites
CITATIONS (3)