cDNA

MGC:109998

ID
ZDB-CDNA-050522-125
Name
MGC:109998
Symbol
MGC:109998
Previous Names
  • FR_8058 (1)
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NIH_ZGC_9
Digest
Insert Size
1700
Cloning Site
EcoRI-PstI
Vector Type
Plasmid
Vector
pME18S-FL3
Polymerase
T3 RNA polymerase
PCR Amplification
Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Quality
( Weak expression pattern )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
6 figures (6 images) from Thisse et al., 2004 [MGC:109998]
Marker Relationships
Sequences
Citations