header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CDNA-050417-272
cDNA Name: MGC:112094
Sequence Ontology ID : SO:0000756
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: NIH_ZGC_17
Digest:
Insert Size: 1545
Cloning Site: EcoRI-PstI
Vector Type: Plasmid
Vector: pME18S-FL3
Polymerase: T3 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Source:
Quality: Rating 3 ( Moderate expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (9 images) from Thisse et al., 2004 [MGC:112094]
MARKER RELATIONSHIPS
MGC:112094 Is Encoded by: [Gene] asb5b (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC093197 (1) 1545bp
OTHER MGC:112094 cDNA PAGESNo links to external sites
CITATIONS (3)