ZFIN ID: ZDB-CDNA-040425-873
cDNA Name: MGC:76805
Sequence Ontology ID : SO:0000756
Previous Name: FR_5497 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: NCI_CGAP_ZEmb2
Digest:
Insert Size: 3510
Cloning Site: NotI-SmaI
Vector Type: phagemid
Vector: pCMV-SPORT6.1
Polymerase: T7 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Source:
Zebrafish Gene Collection (ZGC) (order this)
Quality: Rating 5 ( Simple to use, intense expression pattern restricted to a few structures )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (10 images) from Thisse et al., 2004 [MGC:76805]
MARKER RELATIONSHIPS
MGC:76805 Is Encoded by: [Gene] sox9b (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC067133 (1) 3510bp
Polypeptide GenPept:AAH67133 (1) 398aa
Select Tool
OTHER MGC:76805 cDNA PAGESNo links to external sites
CITATIONS (3)