header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CDNA-040425-75
cDNA Name: MGC:65808
Sequence Ontology ID : SO:0000756
Previous Name: FR396 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: NCI_CGAP_ZKid1
Digest:
Insert Size: 1293
Cloning Site: NotI-SmaI
Vector Type: phagemid
Vector: pCMV-SPORT6.1
Polymerase: T7 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Source:
Location: Unmapped
GBROWSE
GENE EXPRESSION No data available
MARKER RELATIONSHIPS
MGC:65808 Is Encoded by: [Gene] atp6v1e1b (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC057254 (1) 1293bp
OTHER MGC:65808 cDNA PAGESNo links to external sites
CITATIONS (3)