cDNA

MGC:63933

ID
ZDB-CDNA-040425-3613
Name
MGC:63933
Symbol
MGC:63933
Previous Names
  • FR456 (1)
Type
cDNA
Location
Chr: 3 Mapping Details/Browsers
Genome Resources
None
Species
Danio rerio
Library
NCI_CGAP_ZKid1
Digest
Insert Size
1708
Cloning Site
NotI-SmaI
Vector Type
phagemid
Vector
pCMV-SPORT6.1
Polymerase
T7 RNA polymerase
PCR Amplification
Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
7 figures (9 images) from Thisse et al., 2004 [MGC:63933]
Marker Relationships
Sequences
Citations