cDNA Name: MGC:63933
Sequence Ontology ID : SO:0000756
Previous Name: FR456 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: NCI_CGAP_ZKid1
Digest:
Insert Size: 1708
Cloning Site: NotI-SmaI
Vector Type: phagemid
Vector: pCMV-SPORT6.1
Polymerase: T7 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Protocol: Thisse in situ hybridization protocol
Location: Chr: 3 Details
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 7 figures (9 images) from Thisse et al., 2004 [MGC:63933]
High Throughput Expression: GEO (1)
MARKER RELATIONSHIPS
MGC:63933 Is Encoded by: [Gene] junbb (1)
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC053154 (1) 1708 nt
Polypeptide GenPept:AAH53154 (1) 310 aa
Select Tool
Genome Resources:
CITATIONS (4)