cDNA

MGC:77712

ID
ZDB-CDNA-040425-2796
Name
MGC:77712
Symbol
MGC:77712
Previous Names
  • FR_5713 (1)
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NIH_ZGC_10
Digest
Insert Size
1957
Cloning Site
NotI-SmaI
Vector Type
Plasmid
Vector
pExpress-1
Polymerase
T7 RNA polymerase
PCR Amplification
Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TAATACGACTCACTATAGGG 3'
5' GGATCCATTAACCCTCACTAAAGGGAAGTTTCGCTCCGGAATTCCCGGG 3'
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
1 figure (1 image) from Thisse et al., 2004 [MGC:77712]
Marker Relationships
Sequences
Citations