header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CDNA-040425-169
cDNA Name: MGC:64149
Sequence Ontology ID : SO:0000756
Previous Name: FR294 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: NCI_CGAP_ZKid1
Digest:
Insert Size: 1869
Cloning Site: NotI-SmaI
Vector Type: phagemid
Vector: pCMV-SPORT6.1
Polymerase: T7 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Source:
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (5 images) from Thisse et al., 2004 [MGC:64149]
Curated Microarray Expression: GEO (1)
MARKER RELATIONSHIPS
MGC:64149 Is Encoded by: [Gene] myca (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC053281 (1) 1869 bp
OTHER MGC:64149 cDNA PAGES No links to external sites
CITATIONS (4)