Genomic Feature

ihb358

ID
ZDB-ALT-190705-11
Name
ihb358
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with TALEN
Lab of Origin
Zhan Yin Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 22: 11053114 - 11053123 (GRCz11) (1) Details
Nucleotide change
GTGACCAAAA/-
Variant Notes
Between 26 bp to 35 bp of the wild-type insrb coding sequence, TTTTGGTCAC is  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp deleted in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
AAGAACGTGCGTGTGCGCGTCTGGAATCCAGTCGTGCGCGCGCTCGCGAATCCCGCCGAGTCCAGTCACGAGCGCTAATCTAGCCTTCGGGCTGACGCACAGAACGCCAGGCCTAAAGGAACGGCCCATTTTCAGAAGGAGCGGGGGGAGGATGAATGAAAACGCACTTTTAACTACAAATAATTAGATATCACATTCTCATAATGGTAGTAATCGCACTTTTTTGTAATTTACAGTTCATAACAATGATTTAGAATTACTCAATTTAAGCATTAAAGCCATGTTTAAATGATAACATTTCTCCGACATCCCTTTCAACACATGTCGGAGCAGCCGAAGTCTACATGGAGTGAATTCCACAAGTCCCCTCAATTGTAAACTACAACACGCACACATTGAGGAACAACACATCCATAATTCGCGCATTAAAGAGCGTTATAGACAGGCATTACTCACTTTCTCCATGTAGTGATCCGCAGAGGCACAAGATGTAGGCGAAA
GTGACCAAAA/- CAACCACAGATGTGTCCAGCCGCATTCTGCCTCGCGACACGTTTTGGTTTCCTTGGAAAATTAAATCCACCTCTGGTGTGTCCGAAAATCAAAAATTAAAAGGAAAATAAGGTTGTTTGTCTTGTATCAAAAACAACAACAAAAAAGTTAAATCAGACCCCCCAAGAAGGGGACCCGGGGGTCCAGCGTGCTTCAGATAAAGATAATGTTCAACTGAAGTAGTTGTTGCCTAACATTACACAGCAGGGGTGAAATGAGTGTTAAATAACATGATCCTGCACCCTTGAGAAAAATAAACGACTGAAAATCATTTTGAGCGATTTTTCGGATGCATCCTGGCTTTTAGTGGAGCAAGCATGAAAAACGTCCATGCATCTCTTCCATGGAATCAATCCCACACTTCTAGGAATGAGGTACCCTTAAGGGTACAGTACATTGCAACTTTTTCATAACCCCTGCTTTAGTTTGCTACAGCAATATCAGCAAAAAGGTAGACAAGG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations