ZFIN ID: ZDB-ALT-190521-2
Genomic Feature: unt2
Synonyms:
Affected Genomic Regions: vwf (1)
Type: Insertion (1)
Protocol: embryos treated with CRISPR1-vwf
Lab Of Origin: Jag's Lab
Location: Chr 18: 7187395 - 7187396 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 55 bp inserted (1)
FLANKING SEQUENCE (GENOMIC)
CACACTCATTCACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACAATGTACAATTTAGTTTATTTAATTCACCTATAGCTTATGTCAGGACTCAAACCAGCAAGCTTCTTGCTGTGAGGCAACAGTCCTAACCACTGAGCCACCGTGCACCCTTAATAATATTATTAACTACATCAAATAAATGGAAACTTGAACATTGAATGCCCTTTTAATCTCTGATCTCTGTGTTTGCTCAGTGCCGTGTTCAAAACCCATGGACGTGTTGTTCCTGCTGAGAGCGTCTTCAGGAAGCCAGTTTGAGGACTTGAAAACATTTGTGAAAACGTTTATAAAGAGCACAAACATCGGTAAGTCATTGTGACATTGATTTAACATTTTGTTTTGGTGTGTATGCTTTGATGGTTAAATCTAGAACTCCATGTATTTGCTCTGTAGGTCGTAATGACACGCAGGTGGCGGTGATGGTGT
-/GATGGTGTGGACGGGGCGGGATGGTGTGGATGGTGTGGATGGTGTGATGGTGTGG
ACGGGGCGAAATCAGCAGTGGCGGTCACATGGAGAGATGAACAGACACAAGACAACCTTCTCAAGCTGCTGGAATCTCTACACGGCAAAACAGACAACCAGCCACGACTGGGTAAACATGCAGACACAGAGATCACACACACGATACGGTCTGACAGTTCAAATATACGGCCTGCCAAACTCACACGGGTGCTTATTCCTCCGTCTCTGCAGGAGCTGCTCTGCGATTGGCCGTACAGACAGCAGTTTCCTCCACCAGCGGGGCAAGGATGGGCATCCCTAAAGCTGTGGTTATGGTGGTGACGGACAGGTCAATAGACTCAGTGCAAGAGGCAGCAAATGAGGCTCTGACTGCTGGTGGGTAAAATCGTTTTGTAGGGTTATTGATGCACCCTTTTAAGTAGTCTTTAAGGCAAGTTGTTAGGGTTCAATAGAAGCTAAATTCTATCTAGAGCATCTTTAGAATGCTTGCTTTTTTCTGTCAACCTGGCAACCACTCAAT
OTHER unt2 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)