header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190328-5
Genomic Feature: b1369
Synonyms:
Affected Genomic Regions: tjp3 (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR
Lab Of Origin: Adam C Miller Lab
Location: Chr 22: 17676783 - 17676785 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 1 bp inserted / 3 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TTCATCTATCTGTCTATTCATTATCTGTCTGTCCATCCATTCACCGTCTATCTGTCTATTTCTTTGTCCAGCTTTGATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCGGTTGGTCTGTCTTTCTATCCATTACTGTCATTTACTCACAATGTTAGCGGTCTTCCCGCACTTCCTCAGATTCTGTATGGTGTAGAGTGAAGTGACGTTCTCCATTGAAACACCATTCACCATAACAATCTGATCTCGCGTCCTACGGGCAAGAAATCACATGAGTCTCTATCACCAAAATCAGCTGGCAAGTGAGTTTAGTTTTTCAGTCTTGTACACAAACATGACAGGTTCTACAGGATTTATGCAGGATGTGGAGGAGGAAACACGTGCACTCACTGAAGTCGGCCCA
TGG/C
CGGGACCGGTGGGAATCACATCAGAGACCACCACTGCCGCGTCCCCATTTGCTGGGTTGGGTTTGTCCAGCCCACCTGAGACGGCAAAACCAAAGCCCACCTTGGAATCCTGTGAAAGACAGAATAGAACATAAAAATATGGATGACTAAGGAAGAAAAGGAGAATGTAAAAACATGAATAAATGATGAATATAAAAAAAAAACAAGCAAGTAAAAAGAATCAATCAAACGAGTGGAAAAATAAATGATCAAGCCAAAAGAAATAAAAACAAACAATTGAATGAAAAAAATAATTAAATAAACAATATAAATAAACAAACAAAACAAAAATTAATAAAATTTAACTTTTTTTTAAGAAATAAAAGAACGAGCAAAACAAAAAAGGCAAAAAAATAAATAAAAAAAATAAATAAATAAAATATAGATAATATATAAAATAATATTCATTCATTAATTTTCTTTACGGCTAAGTCATTTTTATAAAATAATATATTTATTTA
OTHER b1369 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Heterozygous tjp3b1369/+ (AB) tjp3 Unknown

CITATIONS  (2)