header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190304-5
Genomic Feature: el570
Synonyms:
Affected Genomic Regions: twist1b (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-twist1b
Lab Of Origin: Crump Lab
Location: Chr 16: 19732820 - 19732826 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 7 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
GTTATAATTACAGGAAATACCGAGTTGATTCCAAAGTGCGCCGGCTGTGCATTGTTTTAAAATCTAATCAAAGCACAACGAATCATTTCAGTAGTTGAGCATGCAATCTCTGTTTTTTCTGTTCATCAAAGAACTGTCAGACATGTCAAGGAAAATATCTTGAGTTTAAAAGAAAAGTTTCCCCCCACCCTCCTTCTCGCGTATTAAGCCTTCTTGGCCAATCATCTCTCTCCTCTCAAACACTTTACCAGACTATAAGAGCTCCCTAACTTTTTTCCTTTCAACCTAACACAAAGTTGCTTGGAATACCTAGTGATCTCCTCCAGAACACGAAACGTACGCGTGGAATTGTATTTCACCCTCATGCTGGAATAACGTCCTTATTCGCACGCGCTTTCAGCAGAGACTTAAGCGAGATGCCCGAAGAGCCCGCGCGAGACTCCTCCAGCTCCCCCGTGTCTCCCGCGGACAGTCTCAGCAACAGCGACGGAGAGCCCGAC
AGGCCAC/-
CAAAAAGGTGCGCAAGGAAAAGACGGTCGAGCAAGAAAAACGGGGAGGATTCCGATAGCTCGACCCTTGGGAAAAGGGGGAAAAAGTCTAGCAACAGCAGCAACAGCCCTCAGTCTTTCGAGGAGCTGCAGACGCAGCGCGTGATGGCGAACGTGCGCGAGCGACAGAGGACGCAGTCGCTCAACGAAGCGTTTGCGGCTTTACGCAAAATCATCCCCACTTTACCTTCCGATAAACTGAGCAAAATACAGACGCTGAAACTCGCCGCCAGGTACATCGATTTTCTCTGTCAGGTTCTACAGAGTGACGAGCTGGACTCCAAGATGGCAAGTTGTAGTTATGTTGCTCACGAGCGTTTGAGCTACGCGTTCTCGGTTTGGAGGATGGAGGGCGCTTGGTCCATGTCTGCATCTCACTAGTGTGCAGGGAAACTTTTTCTTGTTTTGTTTTTAAATGGTACGCTTTCACAATATGCCTGGTTTTTAATGCTGCAACTTTGT
OTHER el570 PAGES No links to external sites

CITATIONS  (1)