Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb335

ID
ZDB-ALT-190123-674
Name
ihb335
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Hong Cao Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
Between 84 bp to 90 bp of the wild-type npc1 coding sequence, GTATCTG is deleted in exon 2
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 2: 3833500 - 3833506 (GRCz11) (1) Details
Nucleotide change
GTATCTG/-
Variant Notes
Between 84 bp to 90 bp of the wild-type npc1 coding sequence, GTATCTG is  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp deleted from position 84 to 90 in Exon 2 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TGTATACTTAGTTATTTGTTTAATTATTTTTCTGTAGTTTATTTAACTATTTATTTATCTTTCTGTTTCTTAATATTTTATTTATCTGTTTAATTAATTATCGGTTTATTTATTTCTCAGCTTAATTAGTCTGTTTGTCCATTTACCCAATATTTGTTTTTCCTCCTATGGCTGCCAATGGTTACAGGTTTTCAATACTCTTCAAATTATCAAATGCTTTCAGAATTAAACAAAAAAAAAAATCTCAAACTAGGGTTAGAAACATGTCAATAATGAGTAAATTATGATTTTTTTTATTTTGCTGAAATATCTCTTTAAGACATTTACAAAATTAAAGTGATTACAACATAGATATTGTCCAACAGAGCATTCTTTTTGTGTACAGACATTTTAAAAGACTTTAAGGCTTATGTTTGATGGTTAAAATCCATCAAATCTCCTGTGTGATTTATTTTGTTGTTGTTGTTGTTGTGTGTTCACTCAGGTGCATGGCCAGCACT
GTATCTG/- GTACGGCGAATGTGGGAACTCCCCAAACGTCCCAGAAAAGAAGTTGAACTGCAATTACACCGGTCCTGCTGTGCCTCTGCCTAATGAAGGACAGGAGCTGCTGCAGGTATGACAATCCACTTTTACACCGTTAGCTTTGTATCGGAAACAGAGATAAAAATTACAATGTCACAATTTTTTGGCTAGATTAACTAAATGATTGATCGGATGATAAATTTTAGGTTAAATTGAAATAAAAAATGGCAAGATTTAAAGGTACGATTCTACCAAAAAAGTACATTTCCTCACTTTTTTTCAATATAAGATATTCTGAAGAAAGTTAGAAGGAAAAAAAATAGCATTGATATCCTTTGATATGGCTAACTGATTTTTTTTATCTAACATTCTTCATTATATCTTCCTTTGTAAAAGAAAGAAGGGTTTTGTTTATTTATTTTTTCTCATTAAGACATCCAGTGAATTATTTTTTTAAAAATGTTTTTTTCTAAAGGAGCTGTGTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations