header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181126-5
Genomic Feature: ihb310
Synonyms:
Affected Genomic Regions: ret (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR2-ret
Lab Of Origin: Yonghua Sun Lab
Location: Chr 13: 25600552 - 25600559 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 1 bp inserted / 8 bp deleted in Exon 4 (1)
FLANKING SEQUENCE (GENOMIC)
GGAAAAACATTTTTAAAAGCACTAAAATTATGTTTAAAAATAAGCAAAAAACTGTTTTTGTACTCACTGTATTCATGAACAGTCCCACGGACATTTCCAAAAATAGCTTTCTCTTCCCTAAACTTGTGTTCAATAGCAAAATTATTTTTGATCCAGGAGTCATTTGTCATCAGGGTCCCCACCAGTTTATTTTGAACTTGGTTTGTGGGATAAACTGGTGTTGTGTCTCTGTCATATACAAACAGAGTCCCAAACACAGTACCCTACAAAAGAGAAAAGCTTATTAATATACAAGATCAAAAAAGCTAAGAAGATTACACACACACACACACACAAAATAGCACACACCTCACTGCGGTCAAACTCTACTAAGACGTCTTCAGTGTCAGTCCCGTTGACATAAGGAGAATTATCATCTTCATCATAGATGTTCACATGTAAAGATCTGAAGACCTCCTCCAGATTTCTTTCTGTTCGTACCATACAGACTATATCCAGAT
GATACACT/A
TCCTTCTCCTCGCGGTCCACTTGTGCTGTGACCACTAGTTCAGAAGTGGAGTCGTCGACCGCAAACGGTACAGAAGATCCTGAATTAAATATAAACAAGCACAGACAATCCATCTTAGAGTAGTGACGGGAGAAAATAAGTTTTCCAAATCTTTAAATGACTTAGACCAATTGCTTCATATAATGATTTTGAAGTGTTCAAATGATCACAGACTGAGTAACTCTGCTGGTCAAATCTGTGCAAATACAACAAAAACCCATGTCAAAAATGTATCAAAAACAGCTTTTACAAACACATTTAGCAAAGATTTATTGACTATAATTGATCAAATGCATTTAGCTAACCATCTAACATCATTAAATATACAACAAATCAGCATAATGTGCCTTCTTTTATCAATTTACAATACTTATTTTGTTTGTTGCATGGTGAGCTCTGCTAAACAGCCCAATGTGAAACTATTTTCTACCATTAAATGATTATTTCAGCCAAAAATTACT
NOTES
Comment Citation
8bp deletion, 1bp insertion. 79bp to 87 bp of the wild-type ret exon 4 coding  ... Zebrafish Nomenclature Committee
OTHER ihb310 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)