header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181024-18
Genomic Feature: um301
Synonyms:
Affected Genomic Regions: gbx1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-gbx1
Lab Of Origin: Sagerström Lab
Location: Chr 24: 34113863 - 34113864 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 2 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
GGTGTGTGTATGTGTGTGTTTATGTCTCAGTATGTGACAAATAGAGGCTGAGACAGGGAGAGCTCCAGACAAAAAACGCATCAGGTCTCAGTCAGTTGGACGGCGAGGACCCTACAGCAGCGCCAGGATAACCGTGGACACACATTTGGGTGATTTGAAGGCCAGTACAGCACGGGATTTATACGACCAGACCGCGCTCAGTTCACCATGCAGAGACCGAGCGGTACGGGCACGGCGTTTTCCATTGATTCTTTGATTGGCACTCCACAGCCACGACCGGGCCACCTGCTCTACACGGGCTACCCGATGTTTATGCCGTACCGACCGCTTATGATTCCACAAGCCCTGTCTCATTCGTCATTACCGTCAGGGATCCCACCTTTGGCACCGCTGGCATCTTTCGCAGGGCGTCTGACCAACACTTTTTGCGCGGGGTTAGGACAGGGAATGCCCTCCATGGTGGCGCTCACCACCACCCTGCCTAGTTTCTCGGACCCTCC
AG/-
ATAGTTTCTACCCCCCGCAGGAGATGCCGGGACCCCGGTTAGGCGCAGACGGGACGGGGATGAACCGGCAAGAGAGCCCGCATGACGAACTCAAAGGCTCCGAACTCCTCAATTTCACGGAAACTTTTCAAGCAGTTGCAGGTGAGCACCGGAGACCAACTCTCTCGCTGACAGGTGGTTTAATTAGGAGCGCAAACAGTTCAACAGCATTTTCCAAAAAAAGTTCTAATTAGAACTCCAAAGAACTTTAAATAGAACTCAAAAGAATGTTTTACAGTCTCAAAGTTCCACAACAAACTTTTATTCTGTAATTGTTTTAGGTAGGCTAACTGGTTTACTGGTGAGTTAGATAGCTAATAAAGTAATTTGTAACCTGAATATAACTTTTTACATCAAAACCCAAAAGTAAAGTGTTTTAAATTAAATAATAATTTCTCAAAAAGAAATACAAATCGTATAAACTTAAAAAATAAAAACGTTATAGGACTAGGCCTACAATA
OTHER um301 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)