ZFIN ID: ZDB-ALT-181002-596
Genomic Feature: sa45693
Synonyms:
Affected Genomic Regions: jag2b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 20: 21447907 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TATCACTGTGACTGCTTTCAAGGATGGGCCGGACAGAACTGTGACATCAG
T/G
CAGTATCTCCTCAAGCTCCTCTCCTCTCTTTTCCTCCATCTTTGAGCTCT
(1)
OTHER sa45693 PAGES
ZMP:sa45693 (1)
GENOTYPESNo data available

CITATIONS  (1)