ZFIN ID: ZDB-ALT-181002-388
Genomic Feature: sa45470
Synonyms:
Affected Genomic Regions: galk1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 35292616 (Zv9) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CAAATGTTAGACATTCGCTCACAGGCAGTGAGTATCCCACCAGACGAAAA
C/T
AATGTGAGGAAGCAGCAGCCATTTTGGGCAAGAAAAGTCTAAGAGAGGCT
(1)
OTHER sa45470 PAGES
ZMP:sa45470 (1)
GENOTYPESNo data available

CITATIONS  (1)