ZFIN ID: ZDB-ALT-181002-246
Genomic Feature: sa45319
Synonyms:
Affected Genomic Regions: itpr3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 21322154 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TTCTCATTTAATTCTCCTAATTTTCTCCTCATTATTCTTTTGTCTCGTTC
A/T
GGCTCATCACACCACTGTAAAGCAGCTGCTGCAGTCCACCATGCGTCTGT
(1)
OTHER sa45319 PAGES
ZMP:sa45319 (1)
GENOTYPESNo data available

CITATIONS  (1)