ZFIN ID: ZDB-ALT-170119-26
Genomic Feature: st74
Synonyms:
Affected Genomic Regions: lamtor4 (1)
Type: Point Mutation (1)
Protocol: embryos treated with ENU
Lab Of Origin: Talbot Lab
Location: Chr 4: 20051522 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
FLANKING SEQUENCE (GENOMIC)
CCGATAACTGCGATTAATTTTCCTCGTCCGGGCATCGTGACTTTGTCTTATATTTTGCTCAAATAAAAGACGCAGAATGGACGAAATGTTTTCCGTTCAGCAGGATCATATGCTTTAATCAGCTGACCACTTCACTTCCGCTTTGCGTAGTCGCGTAAGCGCCTTATTTAGCTGATCTGAGATCTGTGCTGCTCGCGTTAACGACCGACCTGTGTGCGGTGATTATGACAGCGAATCTGATCCTGATACAGATTATTTTTTGTTAAATGCGAGAACAGCGCATAAATCCTAGCAAATTAAATAAAAATCCGCCACGTTTTAGTCATACTAAGATTTTTTATCACATTTTGTACGTTTCCAATGCATATAAACAAAAATAATGTCGAATAAGCAAAACATCTCCTGGAATGACGTTATAAACACGCGACGCTTGATGTCAGTCACGTGAGGCGGGGTGTGAAGGAAAACAGCAGTGTACATTTATCTGCACTGTCTAAAAT
G/A
GTAAATATAATTCTTACCTTTAAAATATTTGTTTAATTAAATGTTTTTTTTATTAAATGTTTTGTTTTAGTGCATTTAGAACTTATAAAACAAAGATTTTGTAAATAATGTGATTGATGATGCAGTCTAATATCATATGAGCTCTGTTAGTGTTTAATTACAGTATTATCGTGTGTTGAATGTCAGACTACTGCTTTGACTCAAGGCTTGGAGAGAATACCCGATCAACTTGGGTACTTGGTTATTAGTGAAGACGGAGTACTCGCGGTAAGCTGTTAAAATTCATAACTTACATTTTCGGAGAACTTGACATGAGGGTGAAATGCGTTGAAAAGAGAATCCTGATTTGGGCAAATGAGAAATAATTAATTAGAATTCAATGTCTGTCAGTCTTATTGTTCTGTCTGTCTCTGTTTGCCTGTCTACACTTTGAGGCAAAATTATTACGCCTCTACTGATACATATTATTTAAAAAAAAATTCCCAAGTTATGATGAACTG
Comment Citation
st74 allele introduces a G to A transition in the first codon of lamtor4,  ... Shen et al., 2016
OTHER st74 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)