header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-170117-7
Genomic Feature: uc39
Synonyms:
Affected Genomic Regions: cyp19a1b (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-cyp19a1b
Lab Of Origin: Draper Laboratory
Location: Chr 25: 4902536 - 4902543 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 7 bp deleted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TAATAAGACAATATCAGTTTGAAACATCAAGCAGCAGAACGAGCTGTTTTTAACGTCTAAAAATCAATAGAGGTTAATGAAACCTGAAGTCTTGAGCCAAAAAGATTTGGCTGCGCATCGTATGCAAGACTACAGTCAATACAAGACTTCTGCTCATGAAAGTAATCAGTATCTAATGGCAGATATAGATTAAATGGATGTTAAATTTGCTACATTTTTTTTAGACTTTTTACACTTGCTTGCTTAGTATAACAGTCTCTTCTCCATTGATCCAAACTCGAGCGATGCTGCCGTATTTCTCATTGTAGTAGTTGCACGCCGTGCCGATGCCCATCCAGAGGAACCGACTGTAACTCAGAACCGGCCCCAGACCCAACCACCAACCGGGACCTAAACACGTATCACAACTATTATGACCAGTGGGTGGGTTGATCCCAGTAAATCTAATGGGGTTTACCTCACCTGGAAGAGCTGATTGATTCCTCCAATTCTTGACACCA
AGAATAT/-
GTGCAGCAGAATCAGCATTAAGGTTCCCGTCAGCAGCAGTAATGTTCCCTGCACCACAGCGCCGATGTTTACCGCATCCTTTACCACATGCTCCATCATCACCTCACATACAGACACACCTTAAAGCACAGAAATCCCTCTCAGAATACATGGAAATGAGGCTGAAAATCTGCAGCATAATTGGCTAATAATGCACTACTCTGTAAGTCCCGTTAAAATGAGTGTCAGTATTGTTAGTTTAAGGATGTCTGTAAGCTAGTGAGCTCCAAAACAGTGTCAAAATTTGCTTTGGAAGTTATACAACTGATATAAACATGTAAGCTTGTAGTTTGTCACTTCAGCCTTAATGGATTAATTTTATTCACGTCACCTCATACTTCAGTTTCTCATCAAATCTTGACCAATCAAATGCTCCCTAATATCTGACATGCCCCGCCCCCTTCAACACGCTTTAAATTTGATGTGCTTGGGCTCAATCACTCTCACTGGCAGAGCAAAGC
NOTES
Comment Citation
stop in Cytochrome P450 domain Dranow et al., 2016
OTHER uc39 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)