ZFIN ID: ZDB-ALT-170117-11
Genomic Feature: lv1
Synonyms:
Affected Genomic Regions: dio2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with zinc finger nuclease
Lab Of Origin: Darras Lab
Location: Chr 17: 16875096 - 16875104 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 9 bp deleted (1)
Protein Consequence: Amino Acid Deletion (1)
FLANKING SEQUENCE (GENOMIC)
ATTCAGAGGCAAAATAACGTCAGAGACTTTTTGGCACAAAAATTGGATGAGTTATACTTGTGTTTACAGTTGTGTGGTAAAGTTCAAATGCTCCTACAATGTAAGAGAATGGCATTATCATAAGCATCTTACTACAAACAAAAATCCAGCGTGAGATCAGCAAGATTATAAGCTCTACTTTTTCCATAAGATGCTTAAAAGTTCTTACAGATGGTGTTAGAAGGGGAAAGAACAAAACCTCATTATCAGTTTAGAGCAGTGACAAAGCCCTCAAGAATATGAAGGATGTTTTTAATACTCATGCAACTGTGAATGTGAAATGTCAAACCTGGTGACATCACATAAGTATCCATAACAACAGAGGCCAATAAACCCAGCTAAAGTGGAATAGTTTTCAGTGTAGTCATGCCTCAACTTTGGTTGGCCATGAGCCAGTGCTCAAATGTATTAACATGTTGATGTTGGATTGTTTTGTTCAGGTGAAATTGGGCGAAGCTGCT
CCAAACTCT/-
AAGGTGGTGAAAGTCACTGGCATCAATAGATGCTGGAGCATCAGCGGTAAGACCCACAACCAGTGCCACCTGCTGGACTTTGAGTCTCCTGATCGCCCGTTAGTGGTCAACTTCGGTTCGGCCACTTGACCCCCCTTTATAAGCCAGCTGCCGGTCTTCCGGCGGATGGTGGAGGAATTTTCAGATGTGGCAGATTTCCTGCTGGTCTACATCGATGAGGCTCACCCTTCAGACGGCTGGGTGGGTCCTCCCATGGAGAACTTTTCGTTTGAAGTGAGGAAACACCGAAATCTGGAGGAGAGGATGTTTGCCGCCAGGACACTTCTGGAGCATTTCTCCTTGCCTCCTCAGTGCCAGTTGGTGGCCGATTGCATGGACAATAATGCCAACATAGCCTACGGTGTGTCCTACGAGAGGGTCTGCATCGTGCAGAAGAATAAAATCGCTTACCTTGGGGGTAAGGGTCCATTTTTTTACAACCTTAAAGATGTTCGGAGGTG
Comment Citation
In-frame deletion of three conserved amino acids: proline, asparagine and  ... Houbrechts et al., 2016
OTHER lv1 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous dio2lv1/lv1 dio2 ♀+/- ♂+/-

CITATIONS  (2)