ZFIN ID: ZDB-ALT-161003-20714
Genomic Feature: sa6350
Synonyms:
Affected Genomic Regions: pdgfc (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 35615490 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATACTGTTATAGTGTGGCAACTGGTGGCAGTCATGGAAAGTTCCAGGATC
C/T
AGCTGACCTTTGACCCACGCTTTGGCCTGGAGGACGCGGAGGAAGGCACT
(1)
OTHER sa6350 PAGES
ZMP:sa6350 (1)
GENOTYPESNo data available

CITATIONS  (1)