ZFIN ID: ZDB-ALT-161003-20361
Genomic Feature: sa29561
Synonyms:
Affected Genomic Regions: rpl17 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 19001668 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
TCCCTCAATTAATGCAGAGGAGGAGGAATGACTCAAGTGAAAAAAGCAGG
T/A
ACACAAAATGGTGCTCGCATTTATTTGCTGTGTCAGAGCGGGGCAGTCCA
(1)
OTHER sa29561 PAGES
ZMP:sa29561 (1)
GENOTYPESNo data available

CITATIONS  (1)