ZFIN ID: ZDB-ALT-161003-20332
Genomic Feature: sa28194
Synonyms:
Affected Genomic Regions: cdh23 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 43200565 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CGCTGATCAGTGTATTTGAATTTCATGTCCTGATCATTTGTTTTTTTTTC
A/G
GGTGAGACTGACGGAATCATCTGCACGTTTGACCTCTTTATGGCTTACGC
(1)
OTHER sa28194 PAGES
ZMP:sa28194 (1)
GENOTYPESNo data available

CITATIONS  (1)