header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-20282
Genomic Feature: sa26107
Synonyms:
Affected Genomic Regions: caskin1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 35650468 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE
CACCGCCTCCCCATATGGCTGCTCGTGAAGTGGACAGCTTGACAAACTCT
G/A
ACTGCGCGAGGAGGGTCCTAGAACAGCCATGAGATCATTCATTCACATTG
(1)
OTHER sa26107 PAGES
ZMP:sa26107 (1)
GENOTYPES No data available

CITATIONS  (1)