ZFIN ID: ZDB-ALT-161003-20065
Genomic Feature: sa941
Synonyms:
Affected Genomic Regions: adgrv1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 48740904 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GATTCCTCTCCCTAAGCTTTCTCAGAGAAGGGGGGACTTTGGGAGAGGTA
C/T
GACTTACACTGACTGCCCTCTACATACCTGCCCGTCCACTGGACCCTTCA
(1)
OTHER sa941 PAGES
ZMP:sa941 (1)
GENOTYPESNo data available

CITATIONS  (1)