ZFIN ID: ZDB-ALT-161003-19560
Genomic Feature: sa8853
Synonyms:
Affected Genomic Regions: itga11b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 25: 1373033 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TTTACCTCTTCTACGGGCTGAAAAACAGCATACAAACCAAATATAAACAG
G/A
TACGAGTTAACTGAGAGTGACTGATAGTTAATAAACATGAATGAACCACA
(1)
OTHER sa8853 PAGES
ZMP:sa8853 (1)
GENOTYPESNo data available

CITATIONS  (1)