header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-19118
Genomic Feature: sa7618
Synonyms:
Affected Genomic Regions: fzd10 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 44297806 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Missense (1)
FLANKING SEQUENCE
CATGCAGCAACCCTGGAAAGTTTCATTATGTGCAAAAGAGTGAGTCCTGT
G/A
CCCCCAAGTGTTACTCCAACGTAGATGTGTACTGGAGCCAGGGCGACAAA
(1)
OTHER sa7618 PAGES
ZMP:sa7618 (1)
GENOTYPES No data available

CITATIONS  (1)