ZFIN ID: ZDB-ALT-161003-18927
Genomic Feature: sa7390
Synonyms:
Affected Genomic Regions: mogs (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 1: 41610195 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Missense (1)
FLANKING SEQUENCE (GENOMIC)
TCAGACGGGCCTGGTCAGATCATAAGAAAGATGGGTAGGCGGAGGAAGAGGGTTGCAACAGGTGATGGAGTTCCAAGTCCAAGAAAGGAGGAAAAGGCACCTGCTCCACCACGCAAGGAGAAGAAGAAAAAAACTGACATCGGGAAAGTGTTCATCAATATATCCATCGGTCTGTGCATCTTCAGCCTCATCTGGTTCTTCTATGCTCTTTATATGCGCTCATCCTTAGCCAGAAGGGTTGTGACACTGCACCCCTCTCCAAGGGTCTTGGATGCTAATAGTTCAAGCCCTGCAGTCTCTCCCGAAAGATACTGGGGTTCCTATCGTCCCCAGGTGTACTTTGGGATGAAAACAAGAAGTCCTCGATCTGTTGTGACAGGTGAGGTGTTTTGTATGCTTTCTCTGTGTGCCCAAATTGCTTAGTTTGTGTGGTTTTTACTTGTCTTCGTGGTGTTGTTACAAACATACCTTTTCTTTAGGTTTAATGTGGATGCACCAGT
T/G
TGCTGAAATGGATGGAAATCTCAGGCACACATGTGAGCAAGGGGACCATTTGCTGGGCTATGGATGGTTAATGCATGATGGAGTCTCTTTTGGAGTCCAGGAGATCCATGACCGGGATTTCACCCTGACCACAGAGTTCGTCAAGCGCATGGGTGGAGATCATGGGGGAGACTGGACTTGGAGAATCACTGCAAAACAACATGTAAATAACACATCTGTCCGTCTAATTATCTCTCTATCTGTCTGTCTAATTATCTGCTTATCTAATTAACTGTTAGTTCGTCTGTCCATCCGTCCAACCATCCGTCTATCTATCCATCTATCTAATTATCTGTCTGTCTGTCTGCCTAATTATCTCTCTATACATCTGTCTATCTAATTTTCTGTCTAGCTAATTATTTAATTAACGGTACATTAGTCTGTCCAACCGTCTGTCTATCCTACCATCCATCCTTCTATCTATCCATCTATATAATTGTCTATCTATCTATCTATCTATC
(1)
OTHER sa7390 PAGES
ZMP:sa7390 (1)
GENOTYPES No data available

CITATIONS  (1)