ZFIN ID: ZDB-ALT-161003-18626
Genomic Feature: sa6937
Synonyms:
Affected Genomic Regions: strap (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 4: 16882611 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
CAGTCCCCTGTGTCACCCTGGCGCAACATAGGTTTGCCATCTGCAAAATTTGAACACAAAAACAAACTTATTTGACAGATACATGACATATGCACACACTTATTTTAAGAAATGCTTACTTTTTAAGCACACTGCCCTGCAAATGTAGGTAAAAATGGTTTTATATTTAAACTTTCTCCTTAATTTTATTTCAGAAAAACATTATTAGCAAGTTATAAATAGCAAAATCATATTGTCAGCCAATGACTATCAAAGCACAACATTGTTCACAATCAAGTAACGTGATAATGTTGTTTTGAAGTCATAATTAAATGTGATTTCAAGCCGAATATTCAAAGTACCATGGTGAACAATATAGGGAGCATGTCACAAGTGGTCACTGCATGAATGTGCAACTATAAAACCAACAATGCCCTGCAATGAGGTTGTGTTTACTGTGAAGAGTTGGTTTTAAGTCCAAGTACATACAAACCTTTACAAGCACTAATGAGGAAATATCC
A/T
TAAGGAGTTATTCCACTGAACGCCAGATCCACAACAGGTCTGGTGTGACCAGAGCAGGTGAGAGGGGTCTGTCTCATGGCCATACTTACTGAGGACCTAAAAAGATGACAGGACACATAAGCAATTGTACTGAAACATAGCTACGTATTTCTTAAAATTCAAGTATCAAATAAGAGATGTACATATGAAAAATCAGAACAGGTGTGCTGGCTAACACAAGCTTGGCTAGTCAAAGAAAAACAATCATTACCTTGCAAAGCTAGCAAATCAACGTCACACACTAGTACTTTGCGGCCAGATTGCGTATCGGGGATGATTGCGGAGCTGCACTCCCAGCTACAGTGCTGTGCCACCAGCTACACGAGGTGTGTGTGTGTGAGTGTGTGTGTGTGTAAGCTAAACTCGAGCCCTCGCTAACGCTACAGGAACATAATGGAAGCACTAGTGTGAAAGCCCGGCCATCATTTCCGGCCCGCGACGCCACGGGGATTGGACAGAAC
(1)
OTHER sa6937 PAGES
ZMP:sa6937 (1)
GENOTYPES No data available

CITATIONS  (1)