ZFIN ID: ZDB-ALT-161003-18524
Genomic Feature: sa6782
Synonyms:
Affected Genomic Regions: lrrc4bb (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 24: 38372621 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AAGTTGAGCTAGTCCCACCTTCTGCAGCGAGCAACGCTTCTGAAGTGGTGCCGACGGATCCACAATGCAGTTCGGCAACGCCTGACGCCACCCATTCAAAGTGAATGGGAAGCGTTGACGCTGACGCCCCGTGTGAATAGGGCGTTAACCTGCAGCTACATCATAACGTATACTTTTTAAAAAGGTGATGTCTATTAATTTTATACACTTTCAATTATGTGATCTGATCTTTACAATTATTAAGAACAGTTTGTGCATTCTGCATTACTTACGACTTTGTGTTTTTTTTTTTATTAGGACACATCTTCACTGACCATTCTTTCATTTTATAACACTTTAAGTCCTAGCAAGTTCAATGTCTGGCATTGTTGTTTTCATATAGGGCCAATTTTGGAAGTTTCTGGATATGACGATGCAGAATCCATGAATTTACCTGTATGGAGTTCTCCTGGAGGTTGAGGTATCGAGTATTGGACGAGATGCTCTGTGGAACTTCATTT
A/C
AGCTTTTTTTGGTACAGATCACTCGACTGGCTTGATTCGAACAGCTACAGAGAGCAGGGCAGGCGGGACTGGCTTCGGCCAATCTAGGTCCAAGGAGGTGTGGCCACAACAAAAGTTGGACCAACCAGATGAGGGGGGAGGGGCTGGAAAAGCCTGTTACCATAGCAGCCTGCATGGCAACTGAGTCATGTCCTGCCCCTTTCCTAAAACAAAAATAGCAAACAGTGAGCATTCAGTGTTCTTAAAGAGATGTAAACATGTAAATCCAGTCATCATATACTTTTCTTTTTTGAGTTTCTTGCTTAAACACAAAAGAAGACATTTTGAATCCAAAATAGGAAGTACAAGTACTTTGGAAATCAATGGTTACAGGTTTTCAGCACTGTTCAATACACTCAAAAAAATAACTGATTGGATGAACTCAATTCAATTGAGGGCAGGATTTCCATCCAATAAATTTGTTTAGCACCAACTAAAAAACACTATTTACACAATTAGAT
(1)
OTHER sa6782 PAGES
ZMP:sa6782 (1)
GENOTYPES No data available

CITATIONS  (1)