ZFIN ID: ZDB-ALT-161003-18426
Genomic Feature: sa665
Synonyms:
Affected Genomic Regions: ctsh (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 18: 26422724 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AAAGTCTAACTCCATGTTTTCTTTTCAAATTTGCAGTACAATAAAAAATA
T/A
GAGATAAATGAATTTTACCAGCGGCTGCAGATATTCCTGGAGAACAAGAA
(1)
OTHER sa665 PAGES
ZMP:sa665 (1)
GENOTYPESNo data available

CITATIONS  (1)