ZFIN ID: ZDB-ALT-161003-18235
Genomic Feature: sa6419
Synonyms:
Affected Genomic Regions: gapdh (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 16: 17194954 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
TTACATTTAACATGCCTTTAGATAAATATTTCTTTATTACACCCCCTACTGGATAAATCATGACTGCATTTAGACACCAAACCAACTTAGTTTAACTAAAAATATGGATATAGTACATGTCTTTCTACAAGTACTTCTAAAAGCTTTAGCCAAATTTATTTAGGTGCTTTATCCATTATCAAAAATGAATAATTTTTCAAACAAGCAAATACTTAAAAAATAAATAAATAAATAATAATAATAATAAAAACACCATTTACCTTACAACTGTGAGAGAGTTGTCATATTTCTCATGGTTGACACCCATGACAAACATGGGGGCATCTGCACTTGGGGCAGAGATGATGACTCTCTTTGCACCACCCTTAATGTGAGCCTACCAGGAGAGCAAAATTTCAGTTACAGAAAAACAATTTTTGTTGCAGGCAGCTTATGTAACATCCATGATTACGTACAGAAGCCTTCTCAATAGTAGTGAAGACACCAGTAGACTCCACAAC
A/T
TAAGTAGCACCTGCATCACCCCACTTAATATTGGCTGGGTCCCTCCTGTTTAGGCAGAGATCATGAGCATAGCCCAATGCTTGCAAAAATAATCATAATAATAATAATAATAATAATAATAATAAAAAAAACCATGCATAGTTTGGAATAACAGCACTCACTCGCTATAGACTGTGATTGCATGACCATCAATGACCAGTTTGCCGCCTTCTGCCTTAACCTCACCCTTGTACTTTCCATGGGTGGAGTCGTACTGGAACATGTAAACCTGTGAAGAAACAAGCACTATAAATATATTCAAAATAACCCCAAAACTAGTTAAAAAAAAATTTTTAAAAAAGGAACTTGCCATGTAATCAAGGTCAATGAATGGGTCATTGATGGCCACAATCTCCACTTTCTTGGTCAAGAAAGCAGCACGGGTCACCAGACGGCCAATGCGACCGAATCTGAAAAAAATAAAAGCTCATTCATAAACACTTGCTTTCATCTCACATTAA
(1)
OTHER sa6419 PAGES
ZMP:sa6419 (1)
GENOTYPES No data available

CITATIONS  (1)