ZFIN ID: ZDB-ALT-161003-17965
Genomic Feature: sa6062
Synonyms:
Affected Genomic Regions: adgrv1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 48817348 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CAAAGTTGTCATGAAAGATCGCCAGTCGGCTGCTACAATTCAACTGAAGG
T/A
AAAACTGAGCACTACACACAATTATTAAAAAGTCTGAGGTCAGTAATCCT
(1)
OTHER sa6062 PAGES
ZMP:sa6062 (1)
GENOTYPESNo data available

CITATIONS  (1)