ZFIN ID: ZDB-ALT-161003-17912
Genomic Feature: sa5994
Synonyms:
Affected Genomic Regions: itga11b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 25: 1349971 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
ACGTTAGCATCACCGTCACAGGATGGCTCAATCTTCACACTTTATTAGCC
G/T
TGAGTATGTTAGAAATAAGTAACGAATAACTGACAAAAATGAGTTTGTCT
(1)
OTHER sa5994 PAGES
ZMP:sa5994 (1)
GENOTYPESNo data available

CITATIONS  (1)